Gene detail

Detail information of GWHGAAZE033718

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIY60712.1	0	rhomboid protein Lonja_RBL13 [Lonicera japonica]
COG	YP_003955000.1	0.0000006	rhomboid family protein
Swissprot	tr\|Q8RXW0\|Y3761_ARATH	0.000000007	Uncharacterized protein At3g17611
trEMBL	tr\|A5BJP0\|A5BJP0_VITVI	2E-175	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN67998.1}
TAIR10	AT3G59520.1	5E-126	RHOMBOID-like protein 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000122	gene	539853	540659	-
GWHAAZE00000122	mRNA	539853	540659	-
GWHAAZE00000122	exon	539853	540659	-
GWHAAZE00000122	CDS	539853	540659	-

Transcript Sequence
>GWHTAAZE033758 ATGGGGAAACCTTTGTTCTATGAAATCTTGGAGAAACCAGCTACAAGTTGTATAATTGGAATTTGCACTGCAATTTGGTTCTTTATACAAAAGAAAAACATTGGTTACTCACATGTGGGATTGAGTTATGAAACTGCAATTGAAGGTCACCATTGGAGGATAATAACCTCTGCATTTTCCCACATAAGTGTTATTCACCTTGTCTTCAATATGAGTGCACTTTGGAGCCTTGGAGTTGTAGAGCAATTAGGGCATATGGGTCTCGGGATCGAGTTCTATCTCCACTACACGCTCGTGATGGTCATCTTATCGGGTGCCCTAGTTTTAGCGGCATACCATGTTTTAATCAACAGATTCAAGATTGAGTACTTTCGAAGAGTCACAGCTGTTGGGTATTCTTGTGTGGTATTCGGGTGGATGACTATTTTATCGATAAAGCAACCCTCGTCAAAGTTGGATCTTTTCGGGTTCCTTTCACTTCCGATTAGTTTTGCTCCGTTTGAATCGCTCATTTTTACTTCCATAATTGTGCCACAAGCGAGTTTTCTTGGGCATTTGTCAGGGATTATCGTTGGGTACTCAATTGGCTGGGGTTTGATTCATGGGATGAACAATTATTGGGCAATTTCTATGTTGGGATGGATTGTGCTTGTGTTTGTGTTCAGTTTGAAACGGTCGGGTGCTTATGATTTCAATTTTCTTGAGATTGAATCTGTTACAGATCCTTCTTTGCCTTCAGTGAGGTTTCTTGCTTCTGGAAATGGGAGAACTTTGCAGATGAGTTCTACCGAAGTCAATATTGTGTAG

Network for GWHGAAZE033718

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0228

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01694.23	Rhomboid	48	201	7.90E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.430
	SRR3591706	second leaf	0.501
	SRR3591707	mature leaf	0.674
	SRR3591708	Shoot apex	0.868
	SRR3591709	Stem	1.633
	SRR3591710	White floral bud	0.792
	SRR3591711	White flower	0.839
	SRR3591712	Green floral bud	0.998
	SRR3591713	Yellow flower	0.860
SRP173429	SRR8316895	Juvenile bud stage	4.476
	SRR8316896	Juvenile bud stage	6.859
	SRR8316897	Juvenile bud stage	10.750
	SRR8316894	Third green stage	3.332
	SRR8316900	Third green stage	11.043
	SRR8316901	Third green stage	10.388
	SRR8316898	Complete white stage	8.173
	SRR8316899	Complete white stage	15.788
	SRR8316903	Complete white stage	13.355
	SRR8316902	Silver flowering stage	7.464
	SRR8316904	Silver flowering stage	11.391
	SRR8316905	Silver flowering stage	5.676
	SRR8316906	Gold flowering stage	19.375
	SRR8316907	Gold flowering stage	15.677
	SRR8316908	Gold flowering stage	20.408
SRP132670	SRR6706286	Control	1.710
	SRR6706287	Light intensity 50%	2.097
	SRR6706288	Light intensity 20%	2.583
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.015
	CNS0095593	Slightly white alabastrum(diploid) 2	5.882
	CNS0095594	Slightly white alabastrum(diploid) 3	5.397
	CNS0095595	Whole white alabastrum(diploid) 2	6.401
	CNS0095596	Whole white alabastrum(diploid) 3	8.101
	CNS0095597	Whole white alabastrum(diploid) 4	6.799
	CNS0095598	Silvery flower (diploied) 1	9.056
	CNS0095599	Silvery flower (diploied) 2	6.723
	CNS0095600	Silvery flower (diploied) 3	16.994
	CNS0095601	Golden flower (diploid) 1	9.820
	CNS0095602	Golden flower (diploid) 2	17.182
	CNS0095603	Golden flower (diploid) 3	13.949
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.090
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.911
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.772
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.804
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.022
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.382
	CNS0095610	Silvery flower (tetraploid) 1	24.659
	CNS0095611	Silvery flower (tetraploid) 2	19.475
	CNS0095612	Silvery flower (tetraploid) 3	30.944
	CNS0095613	Golden flower (tetraploid) 1	17.487
	CNS0095614	Golden flower (tetraploid) 2	20.819
	CNS0095615	Golden flower (tetraploid) 3	26.401
CRA001975	CRR073297	Stem 1	5.821
	CRR073298	Stem 2	4.423
	CRR073299	Stem 3	5.932
	CRR073300	Leaf 1	5.337
	CRR073301	Leaf 2	6.284
	CRR073302	Leaf 3	4.596
	CRR073303	Juvenile bud 1	7.430
	CRR073304	Juvenile bud 2	8.624
	CRR073305	Juvenile bud 3	10.018
	CRR073306	Third green 1	6.873
	CRR073307	Third green 2	6.354
	CRR073308	Third green 3	5.795
	CRR073309	Second white 1	8.036
	CRR073310	Second white 2	7.475
	CRR073311	Second white 3	4.939
	CRR073312	Silver flowering 1	11.795
	CRR073313	Silver flowering 2	13.034
	CRR073314	Silver flowering 3	4.544
	CRR073315	Gold flowering 1	3.600
	CRR073316	Gold flowering 2	4.630
	CRR073317	Gold flowering 3	4.252
	CRR073318	Tawny withering 1	4.436
	CRR073319	Tawny withering 2	7.203
	CRR073320	Tawny withering 3	6.066