Gene detail

Detail information of GWHGAAZE033760

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDY71986.1	1.90805E-36	BnaCnng75420D, partial [Brassica napus]
Swissprot	tr\|Q9SJT7\|VHAA2_ARATH	2E-36	V-type proton ATPase subunit a2
trEMBL	tr\|A0A078K2G1\|A0A078K2G1_BRANA	7E-37	V-type proton ATPase subunit a {ECO:0000256\|RuleBase:RU361189} (Fragment)
TAIR10	AT2G21410.1	1E-31	vacuolar proton ATPase A2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000134	gene	557899	558298	-
GWHAAZE00000134	mRNA	557899	558298	-
GWHAAZE00000134	exon	557899	558045	-
GWHAAZE00000134	exon	558227	558298	-
GWHAAZE00000134	CDS	558227	558298	-
GWHAAZE00000134	CDS	557899	558045	-

Transcript Sequence
>GWHTAAZE033800 ATGCTTAGCATTGAGGTGACAAAGAAGTGTCTTGTGGGAGAAGGGTGGAGCCCTGTGTTTGCAATAAAACAGATTCAGGATGCACTGCAGAGGGCAACAAGTGACTCCAACTCACAAGTTGGTGCTATTCTCCAAGTTTTGCGTATGAAAGAGTTACCACCAACTTATTTTCGAACGAACAAATTTACTTCAGCTTTTCAAGAGATTGTTGATGCGTAC

Network for GWHGAAZE033760

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01496.20	V_ATPase_I	1	73	5.60E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02154	ATPeV0A, ATP6N	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.404
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.019
	SRR3591708	Shoot apex	0.257
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.707
	SRR3591713	Yellow flower	0.182
SRP173429	SRR8316895	Juvenile bud stage	0.381
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.364
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.443
	SRR8316901	Third green stage	0.420
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.346
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.150
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.735
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.051
	SRR6706288	Light intensity 20%	0.265
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.391
	CNS0095596	Whole white alabastrum(diploid) 3	0.220
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.169
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.572
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.068
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.287
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.185
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.466
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.732
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.032
	CNS0095610	Silvery flower (tetraploid) 1	0.932
	CNS0095611	Silvery flower (tetraploid) 2	0.410
	CNS0095612	Silvery flower (tetraploid) 3	0.295
	CNS0095613	Golden flower (tetraploid) 1	0.139
	CNS0095614	Golden flower (tetraploid) 2	1.147
	CNS0095615	Golden flower (tetraploid) 3	0.274
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.803
	CRR073301	Leaf 2	0.342
	CRR073302	Leaf 3	0.121
	CRR073303	Juvenile bud 1	0.707
	CRR073304	Juvenile bud 2	0.193
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.764
	CRR073307	Third green 2	0.265
	CRR073308	Third green 3	0.523
	CRR073309	Second white 1	0.646
	CRR073310	Second white 2	0.641
	CRR073311	Second white 3	0.315
	CRR073312	Silver flowering 1	0.506
	CRR073313	Silver flowering 2	0.203
	CRR073314	Silver flowering 3	0.867
	CRR073315	Gold flowering 1	0.562
	CRR073316	Gold flowering 2	0.919
	CRR073317	Gold flowering 3	1.357
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.602