Gene detail

Detail information of GWHGAAZE033761

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDY71986.1	6.64943E-39	BnaCnng75420D, partial [Brassica napus]
Swissprot	tr\|Q9SJT7\|VHAA2_ARATH	9E-39	V-type proton ATPase subunit a2
trEMBL	tr\|A0A078K2G1\|A0A078K2G1_BRANA	2E-39	V-type proton ATPase subunit a {ECO:0000256\|RuleBase:RU361189} (Fragment)
TAIR10	AT2G21410.1	1E-33	vacuolar proton ATPase A2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000134	gene	789680	790085	+
GWHAAZE00000134	mRNA	789680	790085	+
GWHAAZE00000134	exon	789680	789751	+
GWHAAZE00000134	exon	789933	790085	+
GWHAAZE00000134	CDS	789680	789751	+
GWHAAZE00000134	CDS	789933	790085	+

Transcript Sequence
>GWHTAAZE033801 ATGCTTAGCATTGATGTGACAAAGAAGTGTCTTGTGGGAGAAGGGTGGAGCCCTGTGTTTGCAATAAAACAGATTCAGGATGCACTGCAGAGGGCAACAAGTGACTCCAACTCACAAGTTGGTGCTATTCTCCAAGTTTTGCGTACGAAAGAGTTACCACCAACTTATTTTCGGACGAACAAATTTACTTCAGCTTTTCAAGAGATTGTTGATGCGTACGGGTGA

Network for GWHGAAZE033761

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0006
CFinderModule0136

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01496.20	V_ATPase_I	1	74	1.10E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02154	ATPeV0A, ATP6N	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	48.869
	SRR3591706	second leaf	33.498
	SRR3591707	mature leaf	30.544
	SRR3591708	Shoot apex	29.483
	SRR3591709	Stem	36.926
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.177
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	10.586
	SRR8316894	Third green stage	0.151
	SRR8316900	Third green stage	0.098
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.118
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	2.514
	SRR8316907	Gold flowering stage	0.312
	SRR8316908	Gold flowering stage	29.539
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.047
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.186
	CNS0095597	Whole white alabastrum(diploid) 4	0.149
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.212
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.233
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.449
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.488
	CNS0095606	Slightly white alabastrum(tetraploid) 3	63.925
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.029
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.625
	CNS0095609	Whole white alabastrum(tetraploid) 3	51.963
	CNS0095610	Silvery flower (tetraploid) 1	54.556
	CNS0095611	Silvery flower (tetraploid) 2	43.709
	CNS0095612	Silvery flower (tetraploid) 3	34.363
	CNS0095613	Golden flower (tetraploid) 1	14.054
	CNS0095614	Golden flower (tetraploid) 2	44.742
	CNS0095615	Golden flower (tetraploid) 3	31.254
CRA001975	CRR073297	Stem 1	0.096
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.333
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.219
	CRR073303	Juvenile bud 1	0.294
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.081
	CRR073306	Third green 1	0.151
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.364
	CRR073309	Second white 1	0.762
	CRR073310	Second white 2	0.322
	CRR073311	Second white 3	0.679
	CRR073312	Silver flowering 1	1.008
	CRR073313	Silver flowering 2	0.214
	CRR073314	Silver flowering 3	0.286
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.412
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000