Gene detail

Detail information of GWHGAAZE033794

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008349636.1	6.4465E-40	PREDICTED: tyrosine N-monooxygenase-like [Malus domestica]
COG	YP_004303682.1	0.00000002	cytochrome P450
Swissprot	tr\|Q9M7B8\|C79D1_MANES	8E-37	Valine N-monooxygenase 1
trEMBL	tr\|A0A061FZ73\|A0A061FZ73_THECC	3E-40	Cytochrome p450 79a2 {ECO:0000313\|EMBL:EOY20104.1}
TAIR10	AT4G39950.1	8E-31	cytochrome P450, family 79, subfamily B, polypeptide 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000138	gene	328009	328389	+
GWHAAZE00000138	mRNA	328009	328389	+
GWHAAZE00000138	exon	328009	328389	+
GWHAAZE00000138	CDS	328009	328389	+

Transcript Sequence
>GWHTAAZE033834 ATGTCTGATACGACAGTCGCTGGCTACTTCATACCAAAGGGTAGCCATGTTATTTTGAGTCGATCAGGTCTTGGACACAACCCTAAAATCTGGGACGACCCACTGACCTTTAATCCAGAGCGACACTTGAGGGACGATGGCTCTGAAGTGCTACTAACAGAGTCAGAGCTTCGACTTTTATCTTTTAGTAGTGGGCGAAGAGGATGCACAGGAGTGTTGTTAGGTTCAACAATGACAACAATGCTACTAGCGAGACTTCTTCAATGCTTCACCGAGCTCCACCTACCGAGCCACGCATTGACCTTAGTGATTCATATGACAGTTTGGGTATGGCGAAACCTTTGCATGCACACGCCAGGCCGCGTTTGGGAGATAATTTTT

Network for GWHGAAZE033794

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	2	91	1.60E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.207
SRP173429	SRR8316895	Juvenile bud stage	0.093
	SRR8316896	Juvenile bud stage	0.058
	SRR8316897	Juvenile bud stage	0.389
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.075
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	72.771
	SRR8316904	Silver flowering stage	88.903
	SRR8316905	Silver flowering stage	51.238
	SRR8316906	Gold flowering stage	98.535
	SRR8316907	Gold flowering stage	101.012
	SRR8316908	Gold flowering stage	53.865
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.058
	CNS0095593	Slightly white alabastrum(diploid) 2	0.065
	CNS0095594	Slightly white alabastrum(diploid) 3	0.061
	CNS0095595	Whole white alabastrum(diploid) 2	0.278
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	10.692
	CNS0095599	Silvery flower (diploied) 2	12.896
	CNS0095600	Silvery flower (diploied) 3	31.243
	CNS0095601	Golden flower (diploid) 1	14.386
	CNS0095602	Golden flower (diploid) 2	16.526
	CNS0095603	Golden flower (diploid) 3	17.832
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.014
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.059
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.081
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	10.867
	CNS0095611	Silvery flower (tetraploid) 2	20.619
	CNS0095612	Silvery flower (tetraploid) 3	196.095
	CNS0095613	Golden flower (tetraploid) 1	24.857
	CNS0095614	Golden flower (tetraploid) 2	8.967
	CNS0095615	Golden flower (tetraploid) 3	37.028
CRA001975	CRR073297	Stem 1	0.604
	CRR073298	Stem 2	0.327
	CRR073299	Stem 3	0.474
	CRR073300	Leaf 1	0.330
	CRR073301	Leaf 2	0.199
	CRR073302	Leaf 3	0.536
	CRR073303	Juvenile bud 1	0.339
	CRR073304	Juvenile bud 2	0.661
	CRR073305	Juvenile bud 3	0.942
	CRR073306	Third green 1	325.927
	CRR073307	Third green 2	175.615
	CRR073308	Third green 3	191.578
	CRR073309	Second white 1	417.941
	CRR073310	Second white 2	460.791
	CRR073311	Second white 3	413.749
	CRR073312	Silver flowering 1	346.807
	CRR073313	Silver flowering 2	328.922
	CRR073314	Silver flowering 3	272.231
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.129
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.185
	CRR073319	Tawny withering 2	0.122
	CRR073320	Tawny withering 3	0.000