Gene detail

Detail information of GWHGAAZE033796

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007011306.1	2.6909E-109	Cytochrome p450 79a2 [Theobroma cacao]
COG	YP_004596270.1	3E-15	Unspecific monooxygenase
Swissprot	tr\|Q9M7B7\|C79D2_MANES	6E-106	Valine N-monooxygenase 2
trEMBL	tr\|A0A061FSN8\|A0A061FSN8_THECC	1E-109	Cytochrome p450 79a2 {ECO:0000313\|EMBL:EOY20116.1}
TAIR10	AT4G39950.1	5E-80	cytochrome P450, family 79, subfamily B, polypeptide 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000138	gene	334985	335961	+
GWHAAZE00000138	mRNA	334985	335961	+
GWHAAZE00000138	exon	334985	335308	+
GWHAAZE00000138	exon	335398	335436	+
GWHAAZE00000138	exon	335536	335961	+
GWHAAZE00000138	CDS	334985	335308	+
GWHAAZE00000138	CDS	335398	335436	+
GWHAAZE00000138	CDS	335536	335961	+

Transcript Sequence
>GWHTAAZE033836 ATGCAAGATGGAGGACCAGGAGCTGAAGAAGAAGAGCATATCAACGCGGTCTTCTCAATACTCAAGTACACATTTTCTTTTTGTGTTTCTGATTATGTTGGATTTTTACGTGGACGGTTTGATTTAGATGGACAAGAAAAAAACATCAGAAAGGCAGTTGAAAGTGTGAGGAAGTATCAAGATCCTTTAATAGAGAAGAGAGCACAACAATGGGCGAAAGGAACAAGGACAGTGAAAGAAGACTTGCTTGATGTCATGATCTCTCTCCAGAGTGAAGCGGGCATGACTTTGTTGTCTGTTGATGAGATTAAAGCCCAAGTCATTGAAATGATGCTGGCATCAGTGGACAATCCATCGAATGCAGAATCAGATTTGCCAAAGCTGAACTACATTAAGTCATGTGTAAGGGAGGCCTTTAGACTCCATCCTTCTGTACCTTTTAATGTCCCGCATGTATCCATGTCTGATACAACAGTCGCTGGCTACTTCATACCAAAGGGTAGCCATGTGCTTTTGAGTCGATCAGGTCTTGGACGCAACCCAAAAATCTGGGACAACCCACTGACCTTTAATCTAGAGCGACACCTGAGGGACGATGGCTCTGAAGTGGTACTAACAGAGTCAGAGCTTCGACTTTTGTCTTTTAGTAGTGGGCGAAGAGGATGCACAGGAGTGTTGTTGGGTTCAACAATGACAATAATGCTACTAGCGAGACTTCTTCAATGCTTCAGCTGGAGCGCTCCACCTACCAAGCCACGCATTGACCTTAGTGAGTCATATGACAGTTTG

Network for GWHGAAZE033796

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	39	121	9.70E-07
PF00067.23	p450	122	253	3.90E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12153	CYP79A2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Cyanoamino acid metabolism	map00460
		Glucosinolate biosynthesis	map00966

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.126
	SRR3591711	White flower	0.278
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.734
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.022
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	6.399
	SRR8316904	Silver flowering stage	10.066
	SRR8316905	Silver flowering stage	4.252
	SRR8316906	Gold flowering stage	12.269
	SRR8316907	Gold flowering stage	2.555
	SRR8316908	Gold flowering stage	20.085
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.036
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.156
	CNS0095598	Silvery flower (diploied) 1	0.436
	CNS0095599	Silvery flower (diploied) 2	0.300
	CNS0095600	Silvery flower (diploied) 3	3.782
	CNS0095601	Golden flower (diploid) 1	0.506
	CNS0095602	Golden flower (diploid) 2	1.105
	CNS0095603	Golden flower (diploid) 3	3.156
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.075
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.014
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	7.927
	CNS0095611	Silvery flower (tetraploid) 2	17.792
	CNS0095612	Silvery flower (tetraploid) 3	332.829
	CNS0095613	Golden flower (tetraploid) 1	60.742
	CNS0095614	Golden flower (tetraploid) 2	22.382
	CNS0095615	Golden flower (tetraploid) 3	88.466
CRA001975	CRR073297	Stem 1	0.124
	CRR073298	Stem 2	0.084
	CRR073299	Stem 3	0.038
	CRR073300	Leaf 1	0.042
	CRR073301	Leaf 2	0.117
	CRR073302	Leaf 3	0.126
	CRR073303	Juvenile bud 1	0.050
	CRR073304	Juvenile bud 2	0.064
	CRR073305	Juvenile bud 3	0.037
	CRR073306	Third green 1	62.581
	CRR073307	Third green 2	6.576
	CRR073308	Third green 3	18.074
	CRR073309	Second white 1	146.225
	CRR073310	Second white 2	30.011
	CRR073311	Second white 3	242.601
	CRR073312	Silver flowering 1	152.734
	CRR073313	Silver flowering 2	15.202
	CRR073314	Silver flowering 3	153.804
	CRR073315	Gold flowering 1	0.011
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000