Gene detail

Detail information of GWHGAAZE033847

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABK94904.1	8.56323E-91	unknown [Populus trichocarpa]
COG	YP_001840784.1	4E-58	membrane-bound proton-translocating pyrophosphatase
Swissprot	tr\|Q06572\|AVP_HORVU	4E-87	Pyrophosphate-energized vacuolar membrane proton pump
trEMBL	tr\|A9PEV1\|A9PEV1_POPTR	3E-91	Putative uncharacterized protein {ECO:0000313\|EMBL:ABK94904.1}
TAIR10	AT1G15690.1	2E-72	Inorganic H pyrophosphatase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000141	gene	1036873	1039282	+
GWHAAZE00000141	mRNA	1036873	1039282	+
GWHAAZE00000141	exon	1036873	1037062	+
GWHAAZE00000141	exon	1038242	1038300	+
GWHAAZE00000141	exon	1039076	1039282	+
GWHAAZE00000141	CDS	1036873	1037062	+
GWHAAZE00000141	CDS	1038242	1038300	+
GWHAAZE00000141	CDS	1039076	1039282	+

Transcript Sequence
>GWHTAAZE033887 ATGGTAGAAGAGGTTCGACGCCAGTTCAATACTATTCCGGGGCTTATGGAAGGGACTACGAAACCCGACTATGCAACTTGTGTTAAAATTTCCACAGATGCGTCACTAAAAGAAATGATCCCACCAGGTGCTTTGGTAATTCTCTCGCCGTTGATTGCCGGTACATTCTTCGGTGTAGAAACACTTGCCGGTTGCCATTTCGCTTCAAACACCGGTGGAGCATGGGATAATGCCAAGAAGTACATTGAGGCTGGTGCATCGGAACACGCACGATCACTGGGGCCCAAGGGATCGGACGCTCATAAGGCCGCCGTGATAGGTGACACTGTCGGAGATCCCCTCAAAGACACATCTGGACCGTCGCTTAACATCCTCATTAAGCTGATGGCAGTCGAATCTTTGGTCTTTGCCCCGTTCTTTGCAGCTCATGGCGGATTGCTCTTCAAATGGCTTTAA

Network for GWHGAAZE033847

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0098

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03030.17	H_PPase	1	136	2.20E-55

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0016020	cellular_component	membrane
GO:0004427	molecular_function	inorganic diphosphatase activity
GO:0009678	molecular_function	pyrophosphate hydrolysis-driven proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.473
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.198
	SRR3591708	Shoot apex	0.202
	SRR3591709	Stem	1.894
	SRR3591710	White floral bud	2.410
	SRR3591711	White flower	2.540
	SRR3591712	Green floral bud	2.527
	SRR3591713	Yellow flower	5.284
SRP173429	SRR8316895	Juvenile bud stage	20.790
	SRR8316896	Juvenile bud stage	26.112
	SRR8316897	Juvenile bud stage	8.788
	SRR8316894	Third green stage	4.259
	SRR8316900	Third green stage	12.835
	SRR8316901	Third green stage	13.354
	SRR8316898	Complete white stage	1.627
	SRR8316899	Complete white stage	8.144
	SRR8316903	Complete white stage	0.987
	SRR8316902	Silver flowering stage	0.126
	SRR8316904	Silver flowering stage	1.316
	SRR8316905	Silver flowering stage	0.204
	SRR8316906	Gold flowering stage	1.213
	SRR8316907	Gold flowering stage	0.874
	SRR8316908	Gold flowering stage	4.767
SRP132670	SRR6706286	Control	7.024
	SRR6706287	Light intensity 50%	6.616
	SRR6706288	Light intensity 20%	8.999
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.328
	CNS0095593	Slightly white alabastrum(diploid) 2	20.541
	CNS0095594	Slightly white alabastrum(diploid) 3	34.283
	CNS0095595	Whole white alabastrum(diploid) 2	23.506
	CNS0095596	Whole white alabastrum(diploid) 3	27.465
	CNS0095597	Whole white alabastrum(diploid) 4	23.220
	CNS0095598	Silvery flower (diploied) 1	6.041
	CNS0095599	Silvery flower (diploied) 2	4.750
	CNS0095600	Silvery flower (diploied) 3	2.586
	CNS0095601	Golden flower (diploid) 1	5.428
	CNS0095602	Golden flower (diploid) 2	3.084
	CNS0095603	Golden flower (diploid) 3	2.581
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.618
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.020
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.313
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.822
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.129
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.862
	CNS0095610	Silvery flower (tetraploid) 1	1.042
	CNS0095611	Silvery flower (tetraploid) 2	2.858
	CNS0095612	Silvery flower (tetraploid) 3	2.190
	CNS0095613	Golden flower (tetraploid) 1	8.058
	CNS0095614	Golden flower (tetraploid) 2	2.447
	CNS0095615	Golden flower (tetraploid) 3	2.725
CRA001975	CRR073297	Stem 1	37.242
	CRR073298	Stem 2	33.550
	CRR073299	Stem 3	53.593
	CRR073300	Leaf 1	15.661
	CRR073301	Leaf 2	16.814
	CRR073302	Leaf 3	14.350
	CRR073303	Juvenile bud 1	12.596
	CRR073304	Juvenile bud 2	5.888
	CRR073305	Juvenile bud 3	7.174
	CRR073306	Third green 1	2.159
	CRR073307	Third green 2	2.621
	CRR073308	Third green 3	1.585
	CRR073309	Second white 1	1.022
	CRR073310	Second white 2	0.886
	CRR073311	Second white 3	1.531
	CRR073312	Silver flowering 1	3.243
	CRR073313	Silver flowering 2	4.004
	CRR073314	Silver flowering 3	3.578
	CRR073315	Gold flowering 1	0.692
	CRR073316	Gold flowering 2	2.077
	CRR073317	Gold flowering 3	1.373
	CRR073318	Tawny withering 1	2.346
	CRR073319	Tawny withering 2	2.242
	CRR073320	Tawny withering 3	3.505