Gene detail

Detail information of GWHGAAZE033862

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002527781.1	7.47831E-26	conserved hypothetical protein [Ricinus communis]
trEMBL	tr\|B9SP62\|B9SP62_RICCO	3E-26	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF34591.1}
TAIR10	AT1G11880.1	0.00000001	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000143	gene	475204	475542	+
GWHAAZE00000143	mRNA	475204	475542	+
GWHAAZE00000143	exon	475204	475542	+
GWHAAZE00000143	CDS	475204	475542	+

Transcript Sequence
>GWHTAAZE033902 ATGACGAGGAGCATTCAAAATTCAATTGAAAAAAATCACGCCGCCACCACCACCACCACCACCACCACCAATCACACTCGCCTCATTTTCCGATCAGCAATCGCATCAAGACTCCTTGTCATAGCACTAATCATACTCTGGAGGAATCTCCTCAGCCCCTACGACACCTCTGCATCATTAAACCCTAATAATTGCATCTCTTCTTCCTCCTCCAACAATGGCAGCAGCAGCCATGGCATTAACATTCGCTTCCCTCGCAGTGCTTCAGCTATTGAAGAGAGCATCGCGTGGGACGGCGTCTACTTCGTCCTAATCGCGCAATGCGGGGGTTACGAATAG

Network for GWHGAAZE033862

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	30	111	2.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.286
	SRR3591706	second leaf	1.315
	SRR3591707	mature leaf	2.573
	SRR3591708	Shoot apex	1.875
	SRR3591709	Stem	2.843
	SRR3591710	White floral bud	3.367
	SRR3591711	White flower	1.266
	SRR3591712	Green floral bud	2.814
	SRR3591713	Yellow flower	1.617
SRP173429	SRR8316895	Juvenile bud stage	1.097
	SRR8316896	Juvenile bud stage	1.511
	SRR8316897	Juvenile bud stage	1.696
	SRR8316894	Third green stage	0.795
	SRR8316900	Third green stage	1.247
	SRR8316901	Third green stage	2.715
	SRR8316898	Complete white stage	0.502
	SRR8316899	Complete white stage	0.671
	SRR8316903	Complete white stage	0.574
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.201
	SRR8316905	Silver flowering stage	0.051
	SRR8316906	Gold flowering stage	0.978
	SRR8316907	Gold flowering stage	0.817
	SRR8316908	Gold flowering stage	1.834
SRP132670	SRR6706286	Control	3.829
	SRR6706287	Light intensity 50%	3.265
	SRR6706288	Light intensity 20%	4.341
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.347
	CNS0095593	Slightly white alabastrum(diploid) 2	1.638
	CNS0095594	Slightly white alabastrum(diploid) 3	1.253
	CNS0095595	Whole white alabastrum(diploid) 2	1.159
	CNS0095596	Whole white alabastrum(diploid) 3	0.838
	CNS0095597	Whole white alabastrum(diploid) 4	1.945
	CNS0095598	Silvery flower (diploied) 1	0.220
	CNS0095599	Silvery flower (diploied) 2	0.604
	CNS0095600	Silvery flower (diploied) 3	0.157
	CNS0095601	Golden flower (diploid) 1	0.580
	CNS0095602	Golden flower (diploid) 2	1.476
	CNS0095603	Golden flower (diploid) 3	0.439
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.522
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.352
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.150
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.228
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.879
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.240
	CNS0095610	Silvery flower (tetraploid) 1	0.160
	CNS0095611	Silvery flower (tetraploid) 2	0.522
	CNS0095612	Silvery flower (tetraploid) 3	0.747
	CNS0095613	Golden flower (tetraploid) 1	0.120
	CNS0095614	Golden flower (tetraploid) 2	0.344
	CNS0095615	Golden flower (tetraploid) 3	0.313
CRA001975	CRR073297	Stem 1	1.539
	CRR073298	Stem 2	1.946
	CRR073299	Stem 3	1.542
	CRR073300	Leaf 1	2.188
	CRR073301	Leaf 2	2.023
	CRR073302	Leaf 3	1.249
	CRR073303	Juvenile bud 1	1.420
	CRR073304	Juvenile bud 2	1.068
	CRR073305	Juvenile bud 3	0.257
	CRR073306	Third green 1	0.722
	CRR073307	Third green 2	0.314
	CRR073308	Third green 3	0.190
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.654
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.314
	CRR073313	Silver flowering 2	2.737
	CRR073314	Silver flowering 3	0.742
	CRR073315	Gold flowering 1	0.827
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.432
	CRR073319	Tawny withering 2	0.785
	CRR073320	Tawny withering 3	0.041