Gene detail

Detail information of GWHGAAZE033863

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011025178.1	1.21299E-27	PREDICTED: GPI mannosyltransferase 2 isoform X2 [Populus euphratica]
trEMBL	tr\|R0IIZ7\|R0IIZ7_9BRAS	2E-27	Uncharacterized protein {ECO:0000313\|EMBL:EOA36883.1}
TAIR10	AT1G11880.1	2E-24	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000143	gene	486039	488031	+
GWHAAZE00000143	mRNA	486039	488031	+
GWHAAZE00000143	exon	486039	486083	+
GWHAAZE00000143	exon	487801	488031	+
GWHAAZE00000143	CDS	486039	486083	+
GWHAAZE00000143	CDS	487801	488031	+

Transcript Sequence
>GWHTAAZE033903 ATGCGCAAAACCGCGGAACAGCGATATATAGAGGGTACAGTGTGGTTGGCAGTGCAGGTTCTTATCGCGGAAGCTTTGCGTTCTATTTGTGTTTTTGTTCCATTTATTACTTTTCAAGCATATGGCTACTATAATATTTGTCTTGGGCATTCTGTGGAGGAAACTAGGCCATGGTGCAAGACAAGAATTCCATTGCTCTACAATTTTATTCTGAGTCACTATTGGTATGTTGGTATCTTCTTCGCCTGGTCTATCTCCTCATTTTCTGTCTTTTAG

Network for GWHGAAZE033863

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	15	85	4.00E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.006
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.040
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.277
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.050
	SRR8316897	Juvenile bud stage	0.230
	SRR8316894	Third green stage	0.117
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	2.579
SRP132670	SRR6706286	Control	0.015
	SRR6706287	Light intensity 50%	0.036
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.707
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.125
	CNS0095597	Whole white alabastrum(diploid) 4	0.431
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.098
	CNS0095603	Golden flower (diploid) 3	0.101
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.087
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.422
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.127
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.162
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000