Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG2541	8.00E-51	Palmitoyl protein thioesterase
nr	gi\|565440201\|ref\|XP_006282773.1\|	2.36E-49	hypothetical protein CARUB_v10006201mg [Capsella rubella]
trEMBL	tr\|R0F2V4\|R0F2V4_9BRAS	9.00E-50	Uncharacterized protein {ECO:0000313\|EMBL:EOA15671.1}
TAIR	AT4G17483	8.00E-51	alpha/beta-Hydrolases superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000091	3658713	3704502	-

Transcript Sequence
>GWHTAAEX018625 GCTAACCTTTAGATATTCCTATACTTCCCTCTATATATTCCCCCCAAATGAAGTTTTTTCTTTTGGGAAATACTCGGAAGCACGGAAAAGGATGATGAGTGCTTCTGTGCTGAAATTCCTCCTCCTGTCCGCGATCGTCTTCCCCTCTCTACCGCGCTCTTTCTCTCTGCCTTTTGTCGTATTTCACGGAATTGGTGGATCGTGCAAAAACAAGGGACAGAATTTCACGTCTTATCTGAGAACATTAGCAGGTTCTGAAGGATACTGCCTAGAAATTGGAAATGGGCGCAGGGATTCATGGTTTATGCCGATTGCAAAGCAGGTAGATATTGCCTGTGCAAAGGTGAAGGCAATGGAGGAGCTAAAGCAGGGTTTTAATGTGGTAGGCCGTTCCCAGGGAGCCTTAATAGCTCGAGCGATGATTCAGACATGCGATGGTGCACCGCCAATTAAAAATTTCATCTCATTGGCTGGCCCTCATGCTGGTACGACTATTGCACCTCGTTGTAAGGATTACTATGCACGCATGCAGGCGTCCAGCGCGCACGCAGCCATGCAGGCCCACAAAGATCGGGTCACGTGCGTGGCTCGTGACGTGCACTCATGTGGGTGCAAACCCAGAGTAGGGTTATGCGAGACAGGCCAGACTTGGTGTGGCTCCTCACCCATCGCTTCACGCAAAGGGAGTGTAAGATAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K01074	PPT	Metabolic pathways	map01100
		Fatty acid metabolism	map01212
		Fatty acid elongation	map00062
		Lysosome	map04142

GO term	Ontology	Name
GO:0098599	Molecular Function	palmitoyl hydrolase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	1.220
SRP064423	SRR2545915	Juvenile tuber	0.760
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.220
	SRR5643515	five period of Gastrodia elata	0.140
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	4.240
	SRR5643528	five period of Gastrodia elata	3.290
	SRR5643658	five period of Gastrodia elata	6.320
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	3.620
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	4.150
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	2.670
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.420
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	5.840
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	3.120
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1.740
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1.860
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	6.760
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	9.510
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	9.420
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	9.420
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.13
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.29